> For the complete documentation index, see [llms.txt](https://edu.abi.am/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://edu.abi.am/molecular-biology/information-flow-in-the-cell/the-genetic-code.md).

# The Genetic Code

In mRNA, nucleotides are used to code for the amino acids that make up proteins. However, with only four different nucleotides available, it's not possible for each nucleotide to directly correspond to one of the twenty amino acids. Instead, nucleotides are combined into "words" called **codons**.

If codons contained only two nucleotides, there would be 16 possible combinations ($$4^{2}$$). However, this would not be sufficient to code for all 20 amino acids. To provide enough codons for twenty amino acids, the **triplet code** is used, where each codon consists of three nucleotides.

With three nucleotides per codon, there are 64 possible combinations ($$4^{3}$$), which is more than enough to code for the 20 amino acids. This **redundancy** in the genetic code means that some amino acids are encoded by more than one codon. For example, the amino acid leucine is coded for by six different codons.

<figure><img src="https://3514673221-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FdDE3NSiCXcu5YQDQmgdU%2Fuploads%2FvB6pdO83fKz5BFuKSl5P%2FFig_53_genetic_code.png?alt=media&amp;token=90e0a6ca-5f7f-473a-ac99-2f0282b2ae0f" alt="" width="432"><figcaption><p>The triplet code<br>Image source: Biorender.com</p></figcaption></figure>

While most codons in the genetic code serve the primary function of coding for amino acids, four codons have special functions. The **start codon** (AUG) not only codes for the amino acid methionine but also serves as the initiation signal for translation, marking the point at which the ribosome begins protein synthesis. Also, there are three **stop codons** in the genetic code: UAA, UAG, and UGA. Unlike other codons, stop codons do not specify any amino acids. Instead, they signal the termination of translation, indicating to the ribosome that the protein synthesis should conclude.

<figure><img src="https://3514673221-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FdDE3NSiCXcu5YQDQmgdU%2Fuploads%2F75sPy1vmbHGa1r2JlZKh%2FFig_55_genetic_code.png?alt=media&amp;token=cc6d1dd0-f528-4213-b1bc-cca248d04009" alt="" width="540"><figcaption><p>The codon table<br>Image source: Biorender.com</p></figcaption></figure>

## <mark style="color:purple;">Question on the topic</mark>

The nucleotide sequence of a fragment of a short RNA molecule is given below. Find the start codon and write the sequence of amino acids in a polypeptide encoded by this RNA using the codon table.

ACUGCAAAUGGAUGCCGGAUUAUGGAGUUAAGAUGUGC

<details>

<summary>Answer</summary>

Met-Asp-Ala-Gly-Leu-Trp-Ser

</details>

During translation, the ribosome reads mRNA in triplets, each coding for one amino acid. Theoretically, the ribosome could read each mRNA molecule using three different **reading frames**, depending on the nucleotide from which translation starts.

<figure><img src="https://3514673221-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FdDE3NSiCXcu5YQDQmgdU%2Fuploads%2FTlPDPPbzzVnqNjoFpieZ%2FFig_54_reading_frame.png?alt=media&amp;token=84f33a83-decb-4bc7-a721-54cf85ba990f" alt="" width="375"><figcaption><p>Three reading frames can be used for the polypeptide synthesis<br>Image source:<br>Untitled image. "Reading frames". Accessed March 11, 2024.<br>https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages-of-transcription </p></figcaption></figure>

However, in the majority of cases, only one of the reading frames is utilised for translation by the ribosome. The choice of the reading frame is determined by the start codon. Once the ribosome encounters the start codon, it establishes the correct reading frame and begins translating the mRNA into a polypeptide chain. Subsequent codons are then read in the same frame.

A striking property of the genetic code is that it is **universal** for all organisms. The same codons encode the same amino acids in virtually all living organisms, from bacteria to plants to animals. This universality suggests that the genetic code is evolutionarily ancient and was likely established in the common ancestor of all currently existing organisms.&#x20;

Minor deviations from the universal genetic code only exist in compact genomes. For example, mitochondria, which possess their separate translation machinery, exhibit slight variations in the genetic code compared to the nuclear genome.
